ПАРАЗИТОЛОГИЯ, 53, 1, 2019

УДК 576.895.121

18S RRNA GENE- AND COX1-GENE-BASED DIVERSITY

OF MONIEZIA SPP. AND AVITELLINA CENTRIPUNCTATA

IN RUMINANTS FROM AL-QADISIYAH PROVINCE, IRAQ

M. A. A. Al-Fatlawi*

College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq

*е-mail: monyerr.abd@qu.edu.iq

Submitted 08.06.2018

The present 18S rRNA gene and Cox1 gene-based work was proposed and performed to detect and

study the history of evolution of tapeworms that could be recognized through the use of molecular

techniques. For this investigation, 14 tapeworms were recovered from 50 intestinal-based content

samples of 50 animals (sheep, goat, cattle, and buffalo). The collected adult tapeworms were first

identified morphologically showing 6 Moniezia expansa and 7 Moniezia benedeni. Then, DNA from

14 worms (9 for the 18S rRNA gene and 5 for the Cox1 gene) was employed for polymerase chain

reaction (PCR) and partial gene sequencing techniques. The results of the PCR recorded amplifications

of all the sequences used for both genes. The sequencing indicated, via the use of 18S rRNA gene,

5 Moniezia benedeni, 3 Moniezia expansa, and 1 Avitellina centripunctata. Moreover, it resulted, via

the utilization of Cox1 gene, 3 Moniezia expansa and 2 Moniezia benedeni. The isolates stood in close

matching with global isolates. The current results provide important criteria for the reliable use of the

techniques utilized in this study.

Keywords: 18S rRNA, Avitellina, Cox1, Moniezia, PCR, sequencing.

DOI: 10.1134/S0031184719010034

ВЫЯВЛЕНИЕ РАЗНООБРАЗИЯ ЦЕСТОД MONIEZIA SPP. И AVITELLINA

CENTRIPUNCTATA ИЗ ЖВАЧНЫХ ЖИВОТНЫХ В ПРОВИНЦИИ АЛЬ-

КАДИСИЯ В ИРАКЕ С ИСПОЛЬЗОВАНИЕМ ГЕНОВ 18S РРНК И COX1

Колледж ветеринарной медицины, Университет Аль-Кадисии, Эд-Дивания, Ирак

е-mail: monyerr.abd@qu.edu.iq

Поступила 08.06.2018 г.

Молекулярно-генетическое исследование по генам 18S рРНК A и Cox1 предпринято для ре-

конструкции эволюции цестод жвачных животных. Исследовано 14 экз. цестод из кишечников

50 животных (овцы, козы, коровы, буйволы). Вначале половозрелые цестоды были идентифи-

цированы морфологически: 6 экз. Moniezia expansa и 7 экз. Moniezia benedeni. Затем ДНК 14

червей (9 для анализа 18SрРНК и 5 для Cox1) были использованы для ПЦР и секвенирования

участков генов. По результатам секвенирования участка гена 18S рРНК выявлены 5 экз. Moniezia

benedeni, 3 экз. Moniezia expansa и 1 экз. Avitellina centripunctata. С помощью анализа гена Cox1

выявлены 3 экз. Moniezia expansa и 2 экз. Moniezia benedeni. Обнаружено близкое совпадение с

последовательностями нуклеотидов генов в глобальном банке данных. Полученные результаты

помогли установить критерии надежного использования молекулярных методик идентификации

цестод.

Ключевые слова: 18S rRNA, Avitellina, Cox1, Moniezia, ПЦР, секвенирование.

Moniezia spp are tapeworms that infest various ruminants such as sheep, goat, cattle, and

buffalos. These worms induce some problems to the health of animals plus to industries

leading to financial losses via the increase cost provided for the treatment and veterinary

services (Kouam et al., 2018). Two species are well-known for their infestation effectiveness

on animal industries; Moniezia benedeni and Moniezia expansa. For the morphological

recognition of these tapeworms, characteristics features are presented on them such as scolex,

neck and strobila. The scolex and neck are measured to be small in sizes with noticed-long

chain of strobili. These interesting worms belong to the family of Anoplocephalidae and the

order of Cyclophyllidea. Extra differences of Moniezia genus that are characterized by the

presence of clear anterior, posterior, mature, and gravid segments of these worms. Another

characteristic feature is that each proglottid has repeated-sexual parts. Moniezia spp. needs

mites as an intermediate host for the lifecycle to be completed via the presence of grass

feeding by the affected animals (Denegri et al., 1998; Aboma et al., 2015; Ohtori et al.,

2015). Avitellina centripunctata is cestode that infests sheep, goats, cattle, and wide range of

ruminants (Yildiz, 2007). The strobili of these worms are characterized by the presence of

thousands of wide-very short proglottids. The lifecycle needs certain species of arthropods,

oribatid mites and barklice, to be completed (Woodland, 1935; Yildiz, 2007). The present

18S rRNA gene and Cox1 gene based work was proposed and performed to detect and study

the history of evolution of tapeworms that could be recognized through the use of molecular

techniques that rely on 18S rRNA and Cox1 genes. For this investigation, 14 tapeworms were

recovered from 50 intestinal-based content samples of 50 animals (sheep, goat, cattle, and

buffalo). PCR and Partial gene sequencing were employed for this present work to fulfill

the goal of the study.

MATERIALS AND METHODS

Sampling

For this work, 50 intestinal-based content samples were collected from 50 animals (sheep,

goat, cattle, and buffalo). The collection work continued from August, 2016 to January, 2017.

The locations of sampling were from different slaughter houses in Al-Qadisiyah province,

Iraq. The tapeworms were placed separately in clean containers that contained PBS. At the

Lab in the college of veterinary medicine, University of Al-Qadisiyah, adult worms were

placed in containers that had 70 % ethanol and stored at -20°C until future work, starting

with DNA extraction. Some of these tapeworms were subjected to morphological-based

identification.

DNA extraction

A piece of the worm, 200mg, was first rinsed thoroughly with water to get rid of ethanol.

KAPA Express Extract Kit (Cape Town, South Africa) or (Roche, Mannheim, Germany) was

used to fulfill the extraction process relying on the protocol provided by the manufacturer.

A NanoDrop was utilized to measure the resulted DNA for quality and quantity.

PCR and sequencing techniques

The technique followed the use of specific primers that were designed using

PrimerQuest Tool (Integrated DNA Technologies, Inc., Belgium) and NCBI-based

websites. The primers of the 18S rRNA gene were F: ACGGTGAAACCGCGAATGG and

R: GACATGACATGCAGTAGCAGTG that amplify a specific region in this gene at

841 bp. Moreover for the Cox1 gene, the primers were F: TGTTGAGTATGTGGTTTGGTGC

and R: AACTACCCACCATACCACAGGATC that amplify a region at 684 bp. DNA from

14 worms (9 for the 18S rRNA gene and 5 for the Cox1 gene) was employed for the PCR. The

kit that was used for the preparation of the mastermix was ordered from (Bionear, Korea).

The instructions of the kit were followed for this purpose. Regarding the conditions of the

thermocycler used were 95°C for 5 min as for the primary denaturation, 35 cycles of (main

denaturation at 94°C for 1 min, for the 18S rRNA and Cox1 55°C and 53°C respectively for

the annealing, for the 18S rRNA and Cox1 55°C for 1 min and 72°C for 2.5 min respectively),

and 72°C for 5 min regarding the finishing extension. the PCR products in the 1.25 % agarose

gels were electrophoresed and visualized via the use of ethidium-bromide-based illumination

screened by a UV imager. All PCR products were sent out for partial-gene sequencing using

Sanger sequencing method (Macrohen Company, Korea). The phylogenetic tree was built up

using maximum likelihood via the use of MEGA 7.0 (Saitou, Nei, 1987; Tamura et al., 2013).

RESULTS

According to the morphological characters, worms belonging to the genus Moniezia were

recognized. The generic characters were as follows: genital pore, clear cirrus sac, vitelline

gland, recognizable testes, and inter-proglottid-based glands. For the species identification,

adult worm and egg features were used to separate between M. expansa and M. benedeni

that were recovered in this study showing 6 Moniezia expansa and 7 Moniezia benedeni

(figs. 1, 2).The results of the PCR recorded amplifications of all the sequences used for both

genes (figs. 3, 4).

The sequencing indicated, via the use of 18S rRNA gene, 5 Moniezia benedeni, 3 Moniezia

expansa, and 1 Avitellina centripunctata. Moreover, it resulted, via the utilization of

Cox1 gene, 3 Moniezia expansa and 2 Moniezia benedeni. The current isolates, MH173843.1,

MH173844.1, MH173845.1, MH173846.1, MH173847.1, MH173848.1, MH201211.1,

MH201212.1 MH201213.1, and MH201214.1 stood in close matching with global isolates

(figs. 5, 6). Tables 1 and 2 provide statistics about the isolates regarding their sampled animals.

DISCUSSION

Moniezia spp. are tapeworms that infest various ruminants such as sheep, goat, cattle,

and buffalos. These worms induce some problems to the health of animals plus to

industries leading to financial losses via the increase costs provided for the treatment and

veterinary services (Diop et al., 2015a; Kouam et al., 2018). Two species are well-known

Fig. 2. A. Moniezia benedeni, T = Testes, Vit = Vittline gland, CS = Cirrus sac, GP = Genital pore,

OV = Ovary. (X10) (The inter-proglottidal glands do not reach to the margin of segments).

B. Moniezia benedeni egg (Triangle). (X40).

for their infestation effectiveness on animal industries. The present study was successful in

determining the presence of Moniezia spp. via the morphological identification. This step

is important in the diagnosis any parasites especially tapeworms that have their external

characteristic features. The use of the PCR technique confirm that worms are identical to

the genus Moniezia, thus confirming the previous studies (Mehlhorn, 2016). These results

agree with (Nguyen et al., 2012) who detected tapeworms via the use of a PCR method. The

18S rRNA gene sequencing analysis revealed 5 Moniezia benedeni, 3 Moniezia expansa,

and 1 Avitellina centripunctata. This technique is proved to be reliable in identifying these

tapeworms, and it is useful in detecting more species than that in the other method, that

Table 2. Shows statistics about the isolates regarding their sampled animals via the use of Cox1 gene

Animal

Cestode species

Cattle

DIQ14

M. benedeni

Cattle

DIQ15

M. benedeni

Sheep

DIQ13

M. expansa

Sheep

DIQ12

M. expansa

Buffalo

DIQ11

M. expansa

Fig. 5. Phylogenetic tree based on the 18S rRNA gene partial sequencing.

utilized Cox1 as a target gene. However, it was consistent, via the utilization of Cox1 gene,

in detecting 3 Moniezia expansa and 2 Moniezia benedeni. The current isolates were placed

in close matching with global isolates on the phylogenetic tree. However, our isolates have

distinct mutations that may occur in the past and let them to branch out from the global

isolates (Yan et al., 2013; Ohtori et al., 2015). The results of the phylogenetic tree may

indicate that these isolates of the sampled animals were from different ancestors (Diop

et al., 2015b; Ohtori et al., 2015; Guo, 2016). In a recent published work by (Haukisalmi

et al., 2018), 6 Moniezia species were identified in 2 clades. Although their results showed

M. expansa and M. benedeni in Clade1 of their phylogenetic tree, some of the 6 species were

Fig. 6. Phylogenetic tree based on the Cox1 gene partial sequencing.

organized in the Clade2. Our results agree to some extent with this work especially when

look at our tree that placed these both species in different clades. These variations could have

been initiated because the geographical differences between Iraq and Finland and Alaska. In

Iraq, the disease control systems may not be as good as the ones in those places, and this may

introduce certain impacts on generating modifications in the nucleotide sequences leading to

the appearance of new strains. The current results provide important criteria for the reliable

use of the techniques utilized in this study.

REFERENCES

Aboma R., Nesibu A., Birhanu H., Yisehak T., Teshale S. 2015. Internal and external parasites of camels (Camelus

dromedarius) slaughtered at Addis Ababa Abattoir, Ethiopia. Journal of Veterinary Medicine and Animal

Health 7 (2): 57-63.

Denegri G., Bernadina W., Perez-Serrano J., Rodriguez-Caabeiro F. 1998. Anoplocephalid cestodes of veterinary

and medical significance: a review. Folia Parasitologica (Praha) 45 (1): 1-8.

Diop G., Yanagida T., Hailemariam Z., et al. 2015a. Genetic characterization of Moniezia species in Senegal and

Ethiopia. Parasitology International 64 (5): 256-260.

Diop G., Yanagida T., Hailemariam Z., et al. 2015b. Genetic characterization of Moniezia species in Senegal and

Ethiopia. Parasitology International 64 (5): 256-260.

Guo A. 2016. Moniezia benedeni and Moniezia expansa are distinct cestode species based on complete mitochondrial

genomes. Acta Tropica 166: 287-292.

Haukisalmi V. et al. 2018. Molecular taxonomy and subgeneric classification of tapeworms of the genus Moniezia

Blanchard, 1891 (Cestoda, Anoplocephalidae) in northern cervids (Alces and Rangifer). Parasitology

International 67 (2): 218-224.

Kouam M.K., Meningue R., Fon D.E. 2018. Parasitic causes of organ condemnation in cattle slaughtered in Fako

abattoirs, South-West region of Cameroon, and estimate of financial losses. Journal of Helminthology 2018:

1-5.

Mehlhorn H. (Ed.) 2016. Encyclopedia of Parasitology. 4th edition. Springer, 3096 pp.

Nguyen T.D., Le Q.D., Huynh V.V., Nguyen S.T., Nguyen T.V., Vu-Khac H. 2012. The development of

PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep

in central Vietnam. Journal of Helminthology 86 (04): 426-429.

Ohtori M., Aoki M., Itagaki T. 2015. Sequence differences in the internal transcribed spacer 1 and 5.8S ribosomal

RNA among three Moniezia species isolated from ruminants in Japan. Journal of Veterinary Medical Science

77 (1): 105-107.

Saitou N., Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Molecular Biology and Evolution 4 (4): 406-425.

Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis

version 6.0. Molecular Biology and Evolution 30 (12): 2725-2729.

Woodland W.N.F. 1935. A New Species of Avitellinine Tapeworm, Avitellina Sandgroundi , from Hippotragus

Equinus. Annals of Tropical Medicine and Parasitology 29 (2): 185-189.

Yan H., Bo X., Liu Y., et al. 2013. Differential diagnosis of Moniezia benedeni and M. expansa (Anoplocephalidae)

by PCR using markers in small ribosomal DNA (18S rDNA). Acta Veterinaria Hungarica 61 (4): 463-472.

Yildiz K. 2007. The scanning electron microscopic examination of Avitellina centripunctata and Thysaniezia ovilla.

Turkiye parazitolojii Derg 31 (4): 292-295.