ПАРАЗИТОЛОГИЯ, 2020, том 54, № 2, с. 145-151.

УДК 616.936

MOLECULAR DETECTION OF PLASMODIUM VIVAX ON DRY BLOOD

SPOT IN EASTERN SUDAN

A. H. Malik^a, M. A. Elsheik^e, M. I. Saeed^a

^aFaculty of Medical laboratory, The National RibatUniversity, Sudan

^bFaculty of Medicine, The National Ribat University, Sudan

^cFaculty of medicine, University of Khartoum, Sudan

^dNational Center for research, Coordinate of malaria research projects, Sudan

^eFaculty of Medicine, The National Ribat Hospital, Sudan

⁕e-mail: moibsaeed@yahoo.com

Received 09.01.2020

Received after revision 06.02.2020

Accepted 07.02.2020

Plasmodium vivax nowadays is emerging as one of the common causative species of malaria

mainly in Sudan. Laboratory studies based on genomic approaches provide an alternative to identify

the increased frequency of recurrent relapses of malaria infections and cases of low parasitemia such

as P. vivax. The main objective of this study was to compare the performance of PCR and RDT to the

gold standard diagnostics microscopy as a mean of detecting Plasmodium vivax parasites during active

malaria. A total of 572 febrile patients were enrolled in the present study from Kassala, Halfa, and

Eastern Nile area of Sudan. The sample was diagnosed by quality, insured microscopy, ICT (Immune-

Chromatography Test) and PCR methods. The results indicated that the incidence of P. vivax infections

among suspected malaria cases was relatively high. The total positive samples number of P. vivax by

three methods was 164; while the three methods detected 71 (28.7%), 70 (28.3%), and 123 (38.8%),

respectively.

The study findings indicated the changing Plasmodium vivax distribution pattern which seemly

attributed to the recent demographic movement and high rate of immigration from neighboring

countries to the east region in the recent years; ending with such rising trend of P.vivax malaria

in eastern Sudan due to which management of the dormant hypnozoite stage when treating the cases

of relapsing malaria. In conclusion, detection of Plasmodium vivax gene showed superior capability

to identify cases of low parasitemia compared to the gold standard diagnostic microscope methods

and reliable mean for adequate detection and primarily tool for eliminating Plasmodium vivax malaria.

Keywords: Malaria, Plasmodium vivax, Molecular ICT, Eastern Sudan

DOI: 10.31857/S1234567806020054

145

Malaria is an infectious febrile disease of humans and other animal species; it’s caused by

Plasmodium parasites (Centers for Disease Control, 2015). According to the WHO estimates,

there were about 228 million cases of malaria in 2018 in the world (WHO, 2019). Reduction

of malaria mortality rates varied from 533 000 in 2010 to 380 000 in 2018 in the WHO

African Region (WHO, 2019). Although malaria case incidence has fallen globally since

2010, the rate of decline has stalled and even reversed in some regions since 2014. Globally,

the total malaria deaths reached 445 000 deaths, about the same number was reported in

2015. In WHO report 2016, 91 countries reported a total of 216 million cases of malaria,

with an increase of 5 million cases over the previous year. The African Region continues to

account for about 90% of malaria cases and deaths worldwidewhile fifteen countries - all but

one in sub-Saharan Africa - carry 80% of the global malaria burden (Mbacham etal., 2019).

Plasmodium vivax is the most frequent and widely distributed cause of recurring (benign

tertian) malaria. P. vivax is one of the five species of malaria parasites that commonly infect

humans. It is less virulent than Plasmodium falciparum, the deadliest of the five, but vivax

malaria can also lead to severe disease and death (Anstey et al., 2012).

Plasmodium vivax infection is becominga major health problem in Sudan. This parasite

species has the broadest geographic distribution of the five malaria species known to infect

humans (Guerra et al., 2009). There are about 2.5 billion people at risk of malaria and an

estimated 80 to 300 million clinical cases of P. vivax annually. Although P. vivax is mainly

endemic in Southeast Asia and Latin America, it has recently been observed in Ethiopia and

Sudan (Mahgoub et al., 2012). However, in recent years many clinicians observed recurrent

relapses of malaria infections in different areas in Sudan suggesting perhaps a higher than

expected transmission of non-falciparum malaria parasites most likely P. vivax since it is

the second most important malaria parasite species in Sudan. The objective of this study

was to compare the reliability of the diagnostics methods for the detection of P. vivaxand to

recommend the best diagnostic option for detection this spices and co-infection.

MATERIALS AND METHODS

Ethical Considerations

The study was approved by the ethical research committee of the Faculty of Medicine, the University

of Ribat, Khartoum, Sudan.

Study Area and Sample Collection

This was a cross-sectional study carried out in eastern area of Sudan. It is the region of Sudan lying

to the west and south of Gedaref state to the Eritrean border. The area is considered mesoendemic for

malaria; transmission follows mainly the vector breeding in the rainy season (July to OctoberWhole-

blood samples were collected from patients with malaria - like symptoms, including fever and/or

146

chills, sweats, headaches, muscle pains, nausea and vomiting. About 3ml of venous blood samples were

collected into an EDTA anticoagulant tube. Additionally, the venous peripheral blood was prepared

as dried blood spots: two 50 μl aliquots of blood from the same patient were applied to filter paper

Whatman Grade No. 3 (Whatman plc, Maidstone, UK), air-dried immediately, placed individually in

sealed plastic bags and the specimens were transported for molecular detection by PCR in the National

center for tropical medicine research,Department of molecular epidemiology.

Lab Diagnosis of Malaria

Thick and thin blood smears were made in the same slide and the rapid diagnostic test (ICT) were

performed immediately.

The collected fresh blood samples were diagnosed for malaria using blood film microscopy and ICT

and confirmed with PCR. Microscopic examination was performed on both thick and thin blood films,

microscopic fields were read at least twice, and the procedure was followed according to quality control

guidelines of WHO. PCR was performed for P. vivaxwith positive and negative control included. Genomic

DNA was extracted from whole blood samples using Chelex method. A fragment of the plasmodial

18S rRNA gene with 121 bp size was amplified by PCR and species identification was

performed with species-specific oligoprobes using the following P. vivaxprimers; rVIV1

(CGCTTCTAGCTTAATCCACAT AACTGATAC), and rVIV2 (ACTTCCAAGCCGAAGCAAAGA

AAGTCCTTA), using the following PCR cycling steps: 95°C for 5 min. Initial denaturation, 94°C for

1 min. Denaturation, 64°C for 2 min. Annealing, 72°C for 2 min. Extension, according to the protocol

adopted from Snounou, Singh (2002).

Statistical Analysis

Data were analyzed using SPSS (statistical package for the social sciences) version twentieth

software.

RESULTS

The participant gender distribution in the study was as follows: more males were affected

by malaria; however, the percentage of females was 53.1% while the percentage of males

was 46.9%.

Comparison of the rapid diagnostic test (RDT) and polymerase chain reaction (PCR)

with the microscopic gold-standard method demonstrated the following. Out of 572 samples,

the total positive malaria patients revealed by microscopy in the three areas of the study

resulted in 71 positive samples (12.4%) due to Plasmodium vivax, in different areas (Table 1).

When the RDT was used, among total number of positive samples, 70(12.3 %) were

positive for Plasmodium vivax (Table 1). On the other hand, among the total number of the

positive samples revealed by polymerase chain reaction (PCR), 123(23.3%) were positive

for Plasmodium vivax (Table 1). According to the method of gold standard microscopy, the

fraction of P. vivax in Halfa, Kassala, and Eastern Nile constituted 12.4,14.1, and 10.9%,

respectively (Table 2).

147

DISCUSSION

In the present study, males were found to be the gender more affected with malaria

(53.1%).

Throughout the entire studied area, the fraction of P. vivax infections among suspected

malaria cases was relatively high (about 38.8 % by PCR). This result is similar to that

previously done in Aljabalain area located in the White Nile state in central Sudan. The most

remarkable result in this study was the unexpected high proportion (about 40% by PCR)

of P. vivax infections among suspected malaria cases, eight times more than that previously

reported in Sudan (Makarim et al., 2016). These results suggest that the change in the infection

pattern is most likely explained by the recent changed composition of the community

resulting from several migrations of people from several Asian and African countries to work

at petroleum and new sugar companies in White Nile area. This can be true especially for

migrants from Ethiopia, where high prevalence of P. vivax infection (31%) among malaria

cases was found (Lo et al., 2015).

The prevalence of P. vivax had been estimated in this work for three areas of study. The

results showed that no statistically significant differences between the three areas of the study

(P-value >0.05) were revealed. This comes with an agreement with a study performed in

relation to the epidemiology and distribution of Plasmodium vivax malaria in Sudan, where

the overall fraction of P. vivax among the malaria cases constituted 26.6% (Amandaet al.,

2017). The prevalence showed significant variations between the states (p<0.001), which

could be explained by differences in population movement, the presence of refugees, and

proximity to Plasmodium vivax endemic neighboring countries. It also varied significantly

with residence status (p<0.001), reflecting the stability of transmission (Amanda et al., 2017).

Accurate diagnosis of Plasmodium species is important not only for establishing the

correct treatment regimen, but also for applying effective malaria control strategies in

endemic regions as in Sudan. The present study compared microscopy and ICT with PCR.

It was found that results obtained by PCR method were superior to those obtained by

microscopy. Sensitivity of microscopy, ICT and PCR were evaluated in this study in order to

determine the most sensitive method that detects more positive cases. The result proved that

PCR was the most sensitive technique (detected 47.0% of the total positive samples) (P-value

<0.001). These results are in agreement with many studies done worldwide for different sero-

prevalence studies comparing the sensitivity of different techniques.

As diagnostic resources are limited in the study area, without a reference laboratory, the

gold standard microscopy remains the reliable, affordable and applicable laboratory method

for diagnosing malaria. PCR diagnosis for malaria is accurate especially for differentiating

between plasmodia species, but it is more expensive and needs well-trained personnel.

148

Table 1. Prevalence of P. vivax infections detected in malaria cases

Detection

Microscopy, %

RDT, %

PCR, %

P. vivax

71(12.4)

70(12.2)

123(21.5)

Negative

501(87.6)

502 (87.8)

449 (78.5)

Table 2. Prevalence of P. vivax infections detected by microscopy from different sites

Sites

P. vivax

Positive n, %

Negative n, %

Halfa

24(12.4)

170(87.6)

Kassala

28(14.1)

170(85.9)

Eastern Nile

19(10.9)

161(89.4)

Total

71(12.4)

501(87.6)

In all the cases, P-value<0.05 statistical significantly different.

Currently, the Sudanese National Malaria Control Program recommends the use of

RDT in those settings where no expert microscopy is available, and maintains microscopic

examination in those places where microscopy is of an adequate level ( Elmardi et al., 2009).

This RDT strategy was investigated earlier in Sudan for the home management of malaria

using artemisinin-based combination therapy ( Elmardi et al., 2009). This is in agreement

with a study performed at Gadarif teaching hospital in eastern Sudan. Based on the findings

of his study, it appears likely that implementation of malaria RDT in Sudan in settings where

microscopic expertise is available should not be recommended (Awadalla et al., 2013).

CONCLUSION

We can conclude that Plasmodium vivax malaria remains a major public health problem

in eastern Sudan. The possibility of low parisitemia infections is increasing and seems to be

more prevalent in future. PCR detects more cases than has been revealed by microscopy,

while RDT reveals similar cases of malaria parasitic infections. The results indicate the

superior capacity of PCR in detection of more cases and raise queries about the possibility of

asymptomatic carrier, recurrent infections, or presence of drug resistance of local or newly

imported resistant strains.

ACKNOWLEDGEMENT

We would like to acknowledge the National Ribat University for the funding of this

research project.

Conflict of interests: all authors declare no conflict of interest.

149

REFERENCES

Amanda G.G., Salah A., Rania T., Elsir A., Badria B.A. 2017. Epidemiology and distribution of Plasmodium vivax

malaria in Sudan. Transactions of The Royal Society of Tropical Medicine and Hygiene, trz044. Available at

https://doi.org/10.1093/trstmh/trz044

Anstey N.M., Douglas N.M., Poespoprodjo J.R., Price R.N. 2012. Plasmodium vivax: clinical spectrum, risk factors

and pathogenesis. Advances in Parasitology 80: 151-201.

Awadalla H.K., Gamal K.A., Ahmed A.M., Salah E.E., Ahmed M.A., Ishag A. 2013. Reliability of rapid diagnostic

test for diagnosing peripheral and placental malaria in an area of unstable malaria transmission in Eastern

Sudan. Diagnost Pathology 8: 59.

Centers for Disease Control and Prevention. Malaria Worldwide. September. 2015 http://www.cdc.gov/malaria/

malaria_worldwide/index.html

Elmardi K.A., Malik E.M., Abdelgadir T., Ali S.H., Elsyed A.H., Mudather M.A., Elhassan A.H., Adam I. 2009.

Feasibility and acceptability of home-based management of malaria strategy adapted to Sudan’s conditions

using artemisinin-based combination therapy and rapid diagnostic test. Malaria Journal 8: 39.

Guerra C.A., Howes R.E., Patil A.P., Gething P.W., Van Boeckel T.P., Temperley W.H., Kabaria C.W., Tatem A.J.,

Manh B.H., Elyazar I.R., Baird J.K., Snow R.W., Hay S.I. 2009. The international limits and population at

risk of Plasmodium vivax transmission in 2009. PLoSNeglected Tropical Diseases. 4: e774. doi: 10.1371/

journal.pntd.000077

Lo E., Yewhalaw D., Zhong D., Zemene E., Degefa T., Tushune K., Ha M., Lee M.-C.,James A.A., Yan G. et al. 2015.

Molecular epidemiology of Plasmodium vivax and Plasmodium falciparum malaria among duffy-positive

and duffy-negative populations in Ethiopia. Malaria Journal 14, article 84. doi: 10.1186/s12936-015-0596-4

Mahgoub H., Gasim G.I., Musa I.R., Adam I. 2012. Severe Plasmodium vivax malaria among Sudanese children at

New Halfa Hospital Eastern Sudan. Parasites and Vectors 5: 154. doi: 10.1186/1756-3305-5-154

Mbacham W.F., Ayong L., Guewo-Fokeng M., Makoge V. 2019. Current situation of malaria in Africa. In: Malaria

Control and Elimination. New York, Humana, 29-44.

Snounou G., Singh B. 2002. Nested PCR analysis of Plasmodium parasites. In: Malaria methods and protocols. New

York, Humana Press, 189-203.

World Health Organization (WHO), 2019. World malaria report 2019 ISBN 978-92-4-156572-1

150

ВЫЯВЛЕНИЕ PLASMODIUM VIVAX В ПЯТНАХ СУХОЙ КРОВИ

МОЛЕКУЛЯРНЫМИ МЕТОДАМИ

С. Г. Абдалла¹, Х. А. Муза^2,*, И. Адам³, С. Е. Г. Эльзаки⁴, А. Х. Малик¹,

М. А. Эльшейк⁵,С. М. Ибрахим¹

¹Факультет медицинской лаборатории, Национальный университет Рибата,

Хартум, Судан

²Отдел бактериологии, Медицинский факультет, Национальный университет Рибата,

Хартум, Судан

³Медицинский факультет, Хартумский университет, Судан

⁴Национальный исследовательский центр,

Центр исследовательских проектов по малярии, Хартум, Судан

⁵Медицинский факультет, Национальный госпиталь Рибата, Хартум, Судан

⁕e-mail: moibsaeed@yahoo.com

Ключевые слова: малярия, Plasmodium vivax, молекулярные методы, Восточный

Судан

РЕЗЮМЕ

В настоящее время Plasmodium vivax становится одним из самых распространенных воз-

будителей малярии в Судане. Лабораторные исследования, основанные на геномных подходах,

служат альтернативой при изучении возросшей частоты повторных рецидивов малярийных ин-

фекций и случаев пониженной паразитемии, наблюдаемых у P. vivax. Целью настоящей работы

было сравнение методов ПЦР и RDT (rapid diagnostic test) со стандартными методами светооп-

тической диагностики Plasmodium vivax. Были исследованы 572 пациента с явно выраженными

признаками лихорадки из Кассалы, Халфы и территории Восточного Нила (Судан). Было про-

ведено сравнение стандартных методов с методами иммунной хроматографии и методами ПЦР.

Результаты показали, что заражение P. vivax среди всех обнаруженных случаев малярии было

относительно высоким. Общее количество положительных реакций на P. vivax всеми методами

составило 164, при этом различные методики определили 71(28.7%), 70 (28.3%) и 23 (38.8%).

В нашем исследовании были обнаружены изменения в характере распространения

Plasmodium vivax в Судане, что, возможно, объясняется последними демографическими изме-

нениями. Эти изменения связаны с эмиграцией в Судан жителей соседних африканских стран,

усилившейся в последние годы. Определение гипнозоитов, покоящейся стадии малярийного

плазмодия, является насущной задачей в выявлении рецидивов малярии. Наше исследование

показало, что выявление генов Plasmodium viva продемонстрировало свое преимущество при

определении плазмодия при низких уровнях паразитемии в сравнении со стандартными свето-

оптическими методами и является адекватным методом для выявления и последующей ликви-

дации малярии.

151