ПАРАЗИТОЛОГИЯ, 2020, том 54, № 6, с. 491-503.

УДК 595.122.2:575.174

GENETIC DIVERSITY IN MONOXENOUS

AND TRIXENOUS DIGENEANS SHARING

ONE MOLLUSCAN HOST SPECIES

^aDepartment of Invertebrate Zoology, St Petersburg University,

Universitetskaya emb., 7/9, Saint Petersburg, 199034 Russia

^bZoological Institute Russian Academy of Sciences,

Universitetskaya emb., 1, Saint Petersburg, 199034 Russia

* e-mail: anya.gonchar@gmail.com, a.gonchar@spbu.ru

Received 04.10.2020

Received in revised form 22.10.2020

Accepted 22.10.2020

Mudsnails Peringia ulvae serve as hosts for many digenean species; some of them differ a lot in

their life cycle pattern. In the north of Europe two contrasting examples are Cryptocotyle concava

(Heterophyidae) with a trixenous life cycle and Bunocotyle progenetica (Hemiuridae) with a mon-

oxenous life cycle. A ~ 870 base pairs long fragment of cox1 gene sequence was used to evaluate

and compare genetic structure within these two species. Our findings suggest that high dispersal of

C. concava keeps differentiation between different locations minimal and haplotype diversity quite

high. In B. progenetica two haplotypes dominate and have at least limited dispersal.

Keywords: Digenea, life cycle, intraspecific diversity, Bunocotyle progenetica, Cryptocotyle con-

cava

DOI: 10.31857/S1234567806060036

Monoxenous life cycles are not common in Digenea, but they occur and represent an

extreme limitation of transmission (Poulin, Cribb, 2002). Such a limitation may offer some

benefits, but also has significant drawbacks. One of the key concerns is the impact of

one-host life cycle on the genetic diversity in a parasite. This impact may seem straightfor-

ward, but it has never been experimentally tested.

When a single host remains in the digenean life cycle, it is always a first intermediate

host. Snails, the typical first intermediate hosts, usually harbour few clones of a parasite

491

following few infection events (Theron et al., 2004; Rauch et al., 2005; Keeney et al., 2007,

2008). Reproduction of the parthenitae - the sporocysts and rediae - does not produce ge-

netic exchange and is in effect asexual. When the life cycle runs within one snail up until

production of eggs or miracidia, these cannot be a result of mating between non-related

parasites. So, in species with a monoxenous life cycle we expect lack of advantage from

sexual reproduction and low genetic diversity.

Apart from sexual reproduction, intraspecific genetic diversity is also supported by spatial

distribution and associated mixing opportunities. The most vagile host in the life cycle -

for digeneans this generally means a vertebrate definitive host - largely determines genetic

structure of a parasite. Birds and mammals provide better dispersal and less structure than

fishes (Blasco-Costa, Poulin, 2013; Feis et al., 2015). Birds can even sustain connection

between parasite populations that are geographically isolated (Gonchar, Galaktionov, 2020).

In a monoxenous life cycle, the most vagile and the only host is a snail.

In the White Sea, the snails Peringia ulvae (along with their close relatives, Ecrobia

ventrosa) serve as hosts for Bunocotyle progenetica (Markowski, 1936) Chabaud & But-

tner, 1959 - the only monoxenous digenean in this region. These snails are also first in-

termediate hosts of other digeneans with more transmission events in their life cycles, for

example, several species from families Microphallidae and Notocotylidae, and a heterophyid

Cryptocotyle concava (Creplin, 1825) Lühe, 1899. The latter is an abundant parasite with

a trixenous life cycle that involves fish second intermediate host and bird definitive host

(a range of species with fish component in their diet, mainly gulls). It thus presents a con-

trasting example to B. progenetica regarding the expected genetic structure. Several studies

have compared these two parasites of P. ulvae (Levakin, 2004, 2005; Levakin et al., 2013),

but never in this particular aspect.

Here I for the first time assessed genetic structure of a monoxenous trematode

(B. progenetica) and that of a trixenous one (C. concava) found in the same region and in

the same molluscan host species.

MATERIALS AND METHODS

The mud snails Peringia ulvae were collected in 2018-2019 in two regions: the Chupa Inlet in

the Kandalaksha Bay of the White Sea (Russia) and the Varangerfjord in the south-western Barents

Sea (Norway). The distance between these regions is about 500 km directly and about 1000 km along

the shore line. In Varangerfjord, all the samples were taken from the same location, the large mudflat

in the head of the fjord. In the Chupa Inlet, sampling took place in four locations within 10 km from

each other. Sampling sites are summarized in fig. 1 and table 1.

Mud snails were collected during low tide using a sieve with a 1 mm mesh size, taken to the

laboratory and dissected under a stereomicroscope to detect infection by digeneans. I selected rediae

of Cryptocotyle concava and Bunocotyle progenetica from an infected snail, rinsed them in sea water

and preserved in 96 % ethanol. Prevalence and intensity were not recorded.

492

Table 1. Collection sites

Region

Site

Coordinates

Varangerfjord, south-western Barents Sea

Varangerbotn

70°10′19.31″N, 28°33′52.42″E

Chupa Inlet, Kandalaksha Bay, White Sea

Sukhaya Salma Bay

66°18′42.12″N, 33°39′18.58″E

Lebyazhya Bay

66°17′39.95″N, 33°35′04.88″E

Levin Navolok Bay

66°17′50.57″N, 33°27′37.51″E

Krasnyi Island

66°25′06.74″N, 33°44′09.03″E

Figure 1. Schematic map showing collection sites in the Barents and White Seas.

Sampling locations are marked with circles: VB - Varangerbotn, LN - Levin Navolok Bay,

LB - Lebyazhya Bay, SU - Sukhaya Salma Bay, KR - Krasnyi Island.

To extract DNA, the ion exchange resin Chelex ® 100, 200-400 mesh, molecular biology grade (Bio-

Rad) was used. A single redia in a small drop of ethanol was transferred to a new 1.5 ml microtube;

any remaining ethanol was evaporated by incubating an opened tube at 35 °C for 1-3 min. Then 200 µl

of 5 % Chelex in Milli-Q water and 2 µl of proteinase K (20 mg/ml) were added to each tube and

samples were incubated at 56 °C for 16-18 hours while mixing at 750 rpm on thermomixer (Eppen-

dorf). Next, the samples were boiled at 90 °C for 8 min and centrifuged at 16,000 g for 10 min while

cooling to 4 °C. DNA in supernatant was carefully transferred to a new tube and stored at -20 °C.

The fragment of cytochrome c oxidase subunit I (cox1) gene sequence was amplified with PCR

in 20 µl reaction mixtures containing 13 µl Milli-Q water, 4 µl ScreenMix HS (Evrogen, Russia),

493

0.5 µl of each forward and reverse primer diluted to 10 pmol/µl and 2 µl of DNA template. I used

JB3 forward primer (TTTTTTGGGCATCCTGAGGTTTAT, Bowles et al., 1993) and trem.cox1.rrnl

(AATCATGATGCAAAAGGTA, Králová-Hromadová et al., 2008) or COIRtrema (CAACAAAT-

CATGATGCAAAAGG, Miura et al., 2005) reverse primer. PCRs were run on a Veriti thermal cycler

(Thermo Fisher Scientific) with the following thermal profile: initial denaturation at 94 °C for 3 min;

35 cycles with 40 s at 94 °C, 40 s at 48 °C (trem.cox1.rrnl) or 51 °C (COIRtrema) and 40 s at

72 °C; final elongation at 72 °C for 7 min; and cooling to 4 °C. PCR products were size-separated with

electrophoresis in a 1 % agarose gel (5 min at 60 V and 40 min at 80 V), stained with SybrGREEN

(Invitrogen); results were visualized and photographed using ChemiDoc MP (Bio-Rad). Sequencing

of fragments was performed directly from PCR mixture and with PCR primers in both directions on

the automated ABI 3500xl genetic analyzer (Applied Biosystems).

To process chromatograms I used Geneious 11.1.4 (https://www.geneious.com). Forward and re-

verse reads were assembled to verify resulting sequence, and the quality was checked by eye. Further

quality control involved ensuring no inappropriate stop codons in a translated sequence (translation

table 21), and testing for the functional effect of the amino acid substitutions using Provean with

a default threshold - 2.5 (Choi et al., 2012). I also used the translated sequence to search for similar

proteins using BLASTP 2.10.1 + (Altschul et al., 1997). The boundaries of cox1 gene were estimated

by aligning to the annotated mitochondrial genome of Metagonimus yokogawai (NC_023249) as

a reference. The alignment of all the obtained sequences was exported in *.nex format for further

analysis. To construct a haplotype network, I used Integer NJ Net method with reticulation tolerance

0.5 in PopART 1.7 (Leigh, Bryant, 2015). To estimate sequence divergence I used MEGA7 (Ku-

mar et al., 2016). Using DnaSP6 (Rozas et al., 2017) I calculated F_ST and Tajima’s D; built a mis-

match distribution graph using population growth-decline model and tested the fit to this model with

a Harpending’s raggedness index r. To test the significance of differences in haplotype diversity between

the Chupa Inlet and the Varangerfjord for C. concava I used the R script “genetic_diversity_diffs

v.1.0.6” (R Core Team, 2015; Alexander et al., 2016).

For comparison, I used partial cox1 sequences of European Cryptocotyle lingua isolates (Blake-

slee et al., 2008; EU876333-EU876430). These were aligned and analyzed in DnaSP6 and MEGA7,

as described above.

RESULTS

A total of 102 specimens were collected: 54 Cryptocotyle concava and 48 Bunocotyle

progenetica. In Varangerfjord only C. concava were found. In Chupa Inlet, Sukhaya Salma

and Lebyazhya Bays were major sampling sites, while from Levin Navolok Bay there were

only five isolates and from Krasnyi Island only one.

I obtained high quality sequences covering 3′-region of the cox1 gene and adjacent

tRNA-coding region for 40 C. concava and 32 B. progenetica isolates. High AT content was

observed in both species: 63.5 % in C. concava and 67.5 % in B. progenetica. Stop codon

was TAA in both species. All the sequences were submitted to GenBank under accession

numbers MT422274-MT422345.

494

Sequences of C. concava were 872-881 base pairs (b. p.) long after trimming, and the

resulting alignment contained 869 positions of which 27 were polymorphic (table 2). Average

genetic divergence within the species was 0.31 ± 0.09 %. In the translated sequence, the

majority of substitutions appeared synonymous, with two exceptions: Val  Ile (position 56

of the amino acid alignment) and Ser  Pro (236). None of these changes were predicted to

have functional effect. Position 264 was a stop codon at the end of the cox1 gene sequence.

The closest BLAST hit was Metagonimus suifunensis (QFS15968) with 87.6 % identity.

A total of 23 C. concava haplotypes were discovered; five of them were shared between

Varangerfjord and Chupa Inlet. The average number of nucleotide differences between these

populations was 2.885 and F_st was 0.12. The differences in haplotype diversity between the

populations is not significant (p = 0.195). The cox1-based haplotype network for C. concava

is in fig. 2a; it has reticulated structure and a repeated starburst pattern. Most haplotypes

differed by one or two substitutions; the maximum difference between the two neighbouring

haplotypes was four substitutions. Haplotype A was dominant in Varangerfjord; haplotype

B occurred in all five sampling sites; 17 haplotypes were unique. Mismatch distribution

was unimodal (fig. 3a).

For B. progenetica sequences were 853-860 b.p., and the alignment was 853 b.p. Aver-

age pairwise distance per site between all sequences was 0.21 ± 0.1 %. Four positions were

polymorphic (table 2). In the translated sequence, three of them appeared non-synonymous:

Ser  Asn (position three of the amino acid alignment), Ile  Val (4), and Thr  Met (239).

None of these changes were predicted to have functional effect. Position 260 was a stop

codon at the end of the cox1 gene sequence. The closest BLAST hit was Isoparorchis

eurytremum (BAO74170) with 74 % identity.

The cox1-based haplotype network for B. progenetica is in fig. 2b. A total of three hap-

lotypes were discovered, the neighbouring haplotypes differing by two or three substitutions.

Haplotypes C (frequency 16) and D (11) were dominant, and were found in both major

sampling sites (Sukhaya Salma and Lebyazhya Bays). Haplotype E (frequency 5) occurred

in all the three sampling sites. Mismatch distribution was bimodal (fig. 3b).

I analyzed 98 cox1 sequences of C. lingua from GenBank. The samples originated from

16 sites in Europe: seven in southern Scandinavia, six in the UK and three along the conti-

nental coast of central Europe. The alignment was 1043 b.p. long, overlapping by 372 b. p.

with the 5′-region of the cox1 alignment for C. concava. There were 19 non-synonymous

substitutions across the whole alignment. The fragment overlapping for C. lingua and

C. concava included 123 amino acids and had 10 fixed differences between the species.

The total number of cox1 haplotypes for C. lingua was 72, with haplotype and nucleotide

diversity values Hd = 0.984 and π = 0.00379.

495

Table 2. Genetic diversity indices based on cox1 sequences

Dataset

b. p.

Tajima’s D

B. progenetica

all

853

0.627

0.00208

1.97

n.s.

C. concava

all

869

0.932

0.00312

2.715

-1.95**

869

0.879

0.00249

2.163

-1.65*

869

0.942

0.00335

2.911

-1.6*

VB - Varangerfjord, CH - Chupa Inlet, b.p. - length of alignment, N - number of samples,

S - Number of polymorphic sites, H - number of haplotypes, Hd - haplotype diversity, π- nucleotide diversity,

K - average number of nucleotide differences, * p < 0.05, ** p < 0.005, n.s. not significant.

Figure 2. Haplotype networks based on cox1 sequence data for (a) Cryptocotyle concava, n=40;

and (b) Bunocotyle progenetica, n=32. Circles indicate haplotypes, their frequencies correspond

to circle sizes. Haplotypes connected by line differ by one (no hatch marks) or more (number

of hatch marks) substitutions. Black dot illustrates a missing haplotype. Capital letters A-E mark

haplotypes mentioned in the text. Sampling locations are represented by different fill patterns.

Levin - Levin Navolok Bay, Krasnyi - Krasnyi Island, Lebyazhya - Lebyazhya Bay,

Sukhaya - Sukhaya Salma Bay.

496

DISCUSSION

This study dealt with two species of trematodes that share the same first intermediate

host, Peringia ulvae, but have a contrasting life cycle strategy. I obtained 72 sequences of

a ~ 870 b.p. long fragment that included a 3′-region of cox1 gene. For Cryptocotyle con-

cava this was the first molecular genetic evidence. Data on Bunocotyle progenetica were,

to the best of our knowledge, the first intraspecific genetic diversity data for a monoxenous

digenean. The study had relatively small sample sizes, relied on one DNA marker and pro-

vided non-exhaustive geographic range of sampling. The latter was especially critical for

B. progenetica which I did not find in northern Norway. Despite these limitations, the results

contribute to building a global picture of genetic diversity in digeneans.

For C. concava, the samples from two distant locations (Varangerfjord and Chupa Inlet)

have shown lack of genetic differentiation. The haplotype network illustrates this well: five

haplotypes are shared between the two locations, and haplotype pattern does not match

a location pattern (fig. 2a). To test these observations I calculated F_stmeasure. It infers ge-

netic differentiation from comparing genetic diversity within and among (sub)populations

(Holsinger, Weir, 2009). In C. concava, F_st = 0.12 indicates gene flow between Varanger-

fjord and Chupa. This gene flow is consistent with the vagility of definitive hosts: birds can

maintain long-distance dispersal of the parasite. This type of life cycle is called allogenic;

the opposite is autogenic when the definitive hosts are fish, and colonization potential is

smaller (Esch et al., 1988). Meta-analysis has also found that genetic structuring is lower

in allogenic trematodes (Blasco-Costa, Poulin, 2013). The study of the two trixenous trema-

tode species - autogenic and allogenic - in a marine environment gave the same result

(Feis et al., 2015). Our results are thus consistent with the established ideas.

The results of this study were compared with those on three other representatives of

Heterophyidae. All of them have a three-host life cycle where a definitive host is a fish-

eating bird or mammal (including humans). First, I re-analyzed the published dataset for

a closely related marine species C. lingua in Europe (Blakeslee et al., 2008), and proved no

differentiation across sampling locations (F_st= 0). Then, the freshwater species Metagonimus

suifunensis in the Russian Far East also follows this trend (F_st= 0.05, excluding the only

sample from the northernmost location which had a highly diverged haplotype) (Tatonova

et al., 2019). However, Haplorchis taichui forms several isolated populations in Vietnam

(Dung et al., 2013) and, at the broader scale, in the mainland Southeast Asia (Thaenkham

et al., 2017). These examples highlight that, although some trends in population genetics

of trematodes have been identified, the case of every species adds new information.

Demographic history of C. concava inferred from sequence data suggests recent popu-

lation expansion. The first evidence is the haplotype network that has star-like features,

showing many unique haplotypes closely related to few central ones (structure similar to

498

type ii “complex star” in Jenkins et al., 2018). Population expansion can also be detected

by neutrality tests, for example Tajima’s D that compares average pairwise differences with

the number of segregating sites. For populations that underwent bottleneck recently it takes

negative value, which is the case for C. concava. Further evidence is the unimodal mismatch

distribution (fig. 3a). Probably the traces of bottleneck event that are observed in C. concava

and C. lingua (Tajima’s D = -2.59) date from the last glacial maximum.

In the Chupa Inlet, C. concava and Bunocotyle progenetica were collected in the same

sites, and even though sample sizes were not equal, the dataset is suitable for comparison.

The number of detected haplotypes (H), haplotype diversity (Hd) and nucleotide diversity

(π) were higher in C. concava (table 2). The difference is also evident from the haplotype

network (fig. 2). Low intraspecific variability in B. progenetica is likely due to its life cycle

that runs within one mollusc individual. This favours local expansion of single haplotypes

but limits dispersal and genetic exchange.

Dispersal of B. progenetica relies on dispersal of its only host, the mollusc. P. ulvae

may spread at the larval stage, but veligers cannot carry a parasite. Juveniles and adults

of mud snails can float at the water surface and thus move much faster than by crawling

(reviewed in Anderson, 1971; Armonies, Hartke, 1995). They may also be able to disperse

once ingested by a bird, passing through the gut still alive (Haase et al., 2010; Cadée, 2011;

van Leeuwen et al., 2012). At the local scale, either of these processes must be happen-

ing in the Chupa Inlet, as we find the same haplotypes of B. progenetica in different spots

throughout the inlet (fig. 2). At the larger scale, biogeographic data on P. ulvae suggest

that gene flow is quite high between the Baltic and the White Sea, probably due to disper-

sal by birds (Wilke, Davis, 2000). It is thus likely that B. progenetica was transferred to

White Sea also from the Baltic, which is consistent with the records of this parasite there

(Markowski, 1936; Reimer, 1961).

Since three B. progenetica haplotypes were detected at the White Sea, at least three

P. ulvae infected with genetically distinct B. progenetica had arrived here at some point. This

could have happened on a single occasion (for example, if snails were carried by the same

bird) or as several independent events. The number of such events may be underestimated

judging from present data: some parasite haplotypes may be unsampled; some could have

become extinct at the White Sea; and some arriving snails could carry genetically identical

parasites.

In any case, we assume that divergence of B. progenetica into the three haplotypes

differing by 2-3 substitutions could not happen within the White Sea. It is a geologically

young water body which formed and was colonized after the end of the last glacial maximum

(LGM), not before 20 kya (Svendsen et al., 2004; Hughes et al., 2016). Considering the

estimate of mutation rate for cox1 gene in digeneans as 2.5 % per Ma (Attwood et al., 2008),

499

the three haplotypes could not have formed at the White Sea. The Baltic Sea was also under

ice during the LGM; the mud snails and parasites could spread here from the refugia at the

Atlantic coast of Europe where B. progenetica is also documented now (Deblock, 1978).

Summing up, our findings on the genetic diversity in C. concava and B. progenetica

illustrate some differences that would be expected between a tri- and monoxenous digenean

species. Data on C. concava expand understanding of dispersal in species with an avian

definitive host. As for B. progenetica, further study of intraspecific variation patterns could

clarify more on its dispersal and persistence abilities. This will require sampling at a larger

geographic scale, and sampling across several years to test whether the same haplotypes

continue to dominate.

ACKNOWLEDGEMENTS

Funding for this study was provided by the Russian Foundation for Basic Research,

grant number 18-34-01001. The study was carried out using the resources of the Educational

and Research Station “Belomorskaia” of St Petersburg University (SPbU) and the White

Sea Biological Station “Kartesh” of the Zoological Institute of Russian Academy of Sci-

ences (ZIN RAS). Sampling was in part supported by ZIN RAS according to the research

programme number AAAA-A19-119020690109-2. The study relied on equipment of the

research resource centre “Molecular and Cell Technologies” SPbU. The author is grateful

to Peter Smirnov for his great assistance with material collection, Prof. Andrei Granovitch

for making sampling in Varangerfjord possible, and to Drs. Anna Romanovich and Aleksey

Masharsky for excellent sequencing support.

REFERENCES

Alexander A., Steel D., Hoekzema K., Mesnick S.L., Engelhaupt D., Kerr I., Payne R., Baker C.S. 2016. What

influences the worldwide genetic structure of sperm whales (Physeter macrocephalus)? Molecular Ecology

25: 2754-2772.

Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J. 1997. Gapped BLAST and

PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25: 3389-3402.

Anderson A. 1971. Intertidal activity, breeding and the floating habit of Hydrobia ulvae. Journal of Marine Bio-

logical Association UK 51: 423-437.

Armonies W., Hartke D. 1995. Floating of mud snails Hydrobia ulvae in tidal waters of the Wadden Sea, and its

implications in distribution patterns. Helgoländer Meeresuntersuchungen 49: 529-538.

Attwood S.W., Fatih F.A., Upatham E.S. 2008. DNA-sequence variation among Schistosoma mekongi populations

and related taxa; phylogeography and the current distribution of Asian schistosomiasis. PLoS Neglected

Tropical Diseases 2 (3): e200.

Blakeslee A.M., Byers J.E., Lesser M.P. 2008. Solving cryptogenic histories using host and parasite molecular

genetics: the resolution of Littorina littorea’s North American origin. Molecular Ecology 17 (16): 3684-3696.

500

Blasco-Costa I., Poulin R. 2013. Host traits explain the genetic structure of parasites: a meta-analysis. Parasitol-

ogy 140 (10): 1316-1322.

Bowles J., Hope M., Tiu W.U., Liu X., McManus D.P. 1993. Nuclear and mitochondrial genetic markers highly

conserved between Chinese and Philippine Schistosoma japonicum. Acta Tropica 55 (4): 217-229.

Cadée G.C. 2011. Hydrobia as “Jonah in the Whale”: shell repair after passing through the digestive tract of

shelducks alive. Palaios 26 (4): 245-249.

Choi Y., Sims G.E., Murphy S., Miller J.R., Chan A.P. 2012. Predicting the functional effect of amino acid sub-

stitutions and indels. PLoS ONE 7 (10): e46688.

Deblock S. 1978. Distribution géographique des cercaires parasites des Mollusques du genre Hydrobia Hartman

des côtes de France. Annales de Parasitologie Humaine et Comparée 53 (6): 577-593.

Dung D.T., Hop N.T., Thaenkham U., Waikagul J. 2013. Genetic differences among Vietnamese Haplorchis taichui

populations using the COI genetic marker. Journal of Helminthology 87 (1): 66-70.

Esch G.W., Kennedy C.R., Bush A.O., Aho J.M. 1988. Patterns in helminth communities in freshwater fish in

Great Britain: alternative strategies for colonization. Parasitology 96: 519-532.

Feis M.E., Thieltges D.W., Olsen J.L., de Montaudouin X., Jensen K.T., Bazaïri H., Culloty S.C., Luttikhuizen

P.C. 2015. The most vagile host as the main determinant of population connectivity in marine macropara-

sites. Marine Ecology Progress Series 520: 85-99.

Gonchar A., Galaktionov K.V. 2020. New data support phylogeographic patterns in a marine parasite Tristriata

anatis (Digenea: Notocotylidae). Journal of Helminthology 94: e79, 1-5.

Haase M., Naser M.D., Wilke, T. 2010. Ecrobia grimmi in brackish Lake Sawa, Iraq: indirect evidence for long-

distance dispersal of hydrobiid gastropods (Caenogastropoda: Rissooidea) by birds. Journal of Molluscan

Studies 76 (1): 101-105.

Holsinger K.E., Weir, B.S. 2009. Genetics in geographically structured populations: defining, estimating and

interpreting F_ST. Nature Reviews Genetics 10 (9): 639-650.

Hughes A.L., Gyllencreutz R., Lohne Ø.S., Mangerud J., Svendsen J.I. 2016. The last Eurasian ice sheets-a

chronological database and time-slice reconstruction, DATED-1. Boreas 45 (1): 1-45.

Jenkins T.L., Castilho R., Stevens, J.R. 2018. Meta-analysis of northeast Atlantic marine taxa shows contrasting

phylogeographic patterns following post-LGM expansions. PeerJ 6: e5684.

Keeney D.B., Waters J.M., Poulin, R. 2007. Clonal diversity of the marine trematode Maritrema novaezealandensis

within intermediate hosts: the molecular ecology of parasite life cycles. Molecular Ecology 16 (2): 431-439.

Keeney D.B., Bryan-Walker K., King T.M., Poulin R. 2008. Local variation of within-host clonal diversity coupled

with genetic homogeneity in a marine trematode. Marine Biology 154 (1): 183-190.

Králová-Hromadová I., Špakulová M., Horáčková E., Turčeková L., Novobilský A., Beck R., Koudela B., Marinculić

A., Rajský D., Pybus M. 2008. Sequence analysis of ribosomal and mitochondrial genes of the giant liver

fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola

hepatica. Journal of Parasitology 94 (1): 58-67.

Kumar S., Stecher G., Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger

datasets. Molecular Biology and Evolution 33 (7): 1870-1874.

Leigh J.W., Bryant D. 2015. PopART: Full-feature software for haplotype network construction. Methods in Ecol-

ogy and Evolution 6 (9): 1110-1116.

Levakin I.A. 2004. The influence of infections with trematodes Bunocotyle progenetica (Hemiuridae) and Cryp-

tocotyle cancavum (Heterophiidae) onto mortality of littoral molluscs Hydrobia ulvae (Gastropoda: Proso-

branchia) in condition of extremely high temperature. Parazitologiia 38 (4): 352-358.

501

Levakin I.A. 2005. The influence of infections with trematodes Bunocotyle progenetica (Hemiuridae) and Cryp-

tocotyle cancavum (Heterophyidae) onto mortality of littoral mollusks Hydrobia ulvae (Gastropoda: Proso-

branchia) after freezing. Parazitologiia 39 (5): 407-413.

Levakin I.A., Nikolaev K.E., Galaktionov K.V. 2013. A case study of singular spectrum analysis application in

parasitology: dynamics of prevalence of Cryptocotyle concavum and Bunocotyle progenetica trematode

parthenitae in Hydrobia ventrosa snails at the White Sea. Parazitologiia 47 (1): 23-37.

Markowski S. 1936. Über die Trematodenfauna der Baltischen Mollusken aus der Umgebung der Halbinsel Hel.

Bull. Acad. Polon. Sci. Lett. B 2: 311.

Miura O., Kuris A.M., Torchin M.E., Hechinger R.F., Dunham E.J., Chiba S. 2005. Molecular-genetic analyses

reveal cryptic species of trematodes in the intertidal gastropod, Batillaria cumingi (Crosse). International

Journal for Parasitology 35 (7): 793-801.

Poulin R., Cribb T.H. 2002. Trematode life cycles: short is sweet? Trends in Parasitology 18 (4): 176-183.

R Core Team. 2015. R: a language and environment for statistical computing. Vienna, Austria, R Foundation for

Statistical Computing. Available at https://www.r-project.org/ (accessed 22 June 2020).

Rauch G., Kalbe M., Reusch T.B.H. 2005. How a complex life cycle can improve a parasite‘s sex life. Journal of

Evolutionary Biology 18 (4): 1069-1075.

Reimer L. 1961. Die Stufen der Progenesis bei dem Fischtrematoden Bunocotyle cingulata Odhner, 1928. Wiadomości

Parazytologiczne 7 (4-6): 843-849.

Rozas J., Ferrer-Mata A., Sánchez-DelBarrio J.C., Guirao-Rico S., Librado P., Ramos-Onsins S.E., Sánchez-Gracia

A. 2017. DnaSP 6: DNA sequence polymorphism analysis of large datasets. Molecular Biology and Evolu-

tion 34: 3299-3302.

Svendsen J.I., Alexanderson H., Astakhov V.I., Demidov I., Dowdeswell J.A., Funder S., Gataullin V., Henriksen

M., Hjort C., Houmark-Nielsen M., Hubberten, H.W., Ingólfsson O., Jakobsson M., Kjær K.H., Larsen

E., Lokrantz H., Lunkka J.P., Lyså A., Mangerud J., Matiouchkov A., Murray A., Möller P., Niessen F.,

Nikolskaya O., Polyak L., Saarnisto M., Siegert C., Siegert M.J., Spielhagen R.F., Stein R. 2004. Late

Quaternary ice sheet history of northern Eurasia. Quaternary Science Reviews 23: 1229-1271.

Tatonova Y.V., Besprozvannykh V.V., Shumenko P.G., Nguyen H.M., Solodovnik D.A. 2019. First description of

genetic diversity for the genus Metagonimus using the complete cox1 gene sequence. International Journal

for Parasitology 49 (12): 985-992.

Thaenkham U., Phuphisut O., Nuamtanong S., Yoonuan T., Sa-Nguankiat S., Vonghachack Y., Belizario V.Y.,

Dung D.T., Dekumyoy P., Waikagul J. 2017. Genetic differences among Haplorchis taichui populations in

Indochina revealed by mitochondrial COX1sequences. Journal of Helminthology 91 (5): 597-604.

Theron A., Sire C., Rognon A., Prugnolle F., Durand P. 2004. Molecular ecology of Schistosoma mansoni trans-

mission inferred from the genetic composition of larval and adult infrapopulations within intermediate and

definitive hosts. Parasitology 129 (5): 571-580.

van Leeuwen C.H.A., van der Velde G., van Lith B., Klaassen M. 2012. Experimental quantification of long distance

dispersal potential of aquatic snails in the gut of migratory birds. PLoS ONE 7 (3): e32292.

Wilke T., Davis G.M. 2000. Infraspecific mitochondrial sequence diversity in Hydrobia ulvae and Hydrobia ven-

trosa (Hydrobiidae: Rissooidea: Gastropoda): do their different life histories affect biogeographic patterns

and gene flow? Biological Journal of the Linnean Society 70 (1): 89-105.

502

ВНУТРИВИДОВАЯ ГЕНЕТИЧЕСКАЯ ИЗМЕНЧИВОСТЬ

У ТРЕМАТОД С МОНО- И ТРИКСЕННЫМ ЦИКЛОМ

ИЗ ОДНОГО ВИДА МОЛЛЮСКОВ-ХОЗЯЕВ

А. Г. Гончар

Ключевые слова: Digenea, трематоды, жизненный цикл, внутривидовая генетиче-

ская изменчивость, Bunocotyle progenetica, Cryptocotyle concava

РЕЗЮМЕ

Моллюски Peringia ulvae служат хозяевами для многих видов трематод, которые при этом

могут сильно различаться по структуре своих жизненных циклов. На севере Европы два кон-

трастных примера - это виды Cryptocotyle concava (Heterophyidae) с триксенным жизненным

циклом и Bunocotyle progenetica (Hemiuridae) с моноксенным. Мы секвенировали фрагмент гена

сох1 длиной ~ 870 пар нуклеотидов для оценки и сравнения генетической структуры внутри

этих видов. Наши результаты свидетельствуют о том, что активное распространение C. concava

ограничивает дифференциацию между различными географическими регионами и поддержи-

вает довольно высокое разнообразие гаплотипов. У B. progenetica два гаплотипа доминируют

и имеют по крайней мере некоторый потенциал для распространения.

503