Генетика, 2020, T. 56, № 3, стр. 366-370

Полиморфные локусы генов DNMT1 и DNMT3A и ранние репродуктивные потери

А. А. М. Ахмед 1, М. М. Азова 1*, Ф. У. Рамазанова 1, О. Б. Гигани 1

1 Российский университет дружбы народов
117198 Москва, Россия

* E-mail: azovam@mail.ru

Поступила в редакцию 04.04.2019
После доработки 11.06.2019
Принята к публикации 02.07.2019

Полный текст (PDF)

Аннотация

ДНК-метилтрансферазы DNMT3A и DMNT1 необходимы для создания паттернов метилирования de novo и их поддержания во время эмбриогенеза и гаметогенеза. Инактивация кодирующих их генов приводит к гибели эмбрионов. Нами выполнено исследование типа “случай–контроль” с целью изучения ассоциации генных вариантов DNMT3А rs7590760, DNMT1 rs2228611 и DNMT1 rs8101626 с предрасположенностью к ранним репродуктивным потерям у женщин русской национальности. В исследование были включены 100 женщин с потерей беременности на ранних сроках (РПБ), которые далее были разделены на 2 подгруппы, каждая из которых включала 50 пациенток: со спорадической (СПБ) и повторной (ППБ) потерей беременности. Контрольная группа состояла из 56 женщин с нормально протекавшими беременностями. Для генотипирования использовался метод полимеразной цепной реакции с последующей рестрикцией ДНК. При сравнении с контрольной группой установлено, что генотип GG и аллель G по DNMT1 rs2228611 ассоциирован с РПБ и ППБ. Также с РПБ, включая СПБ и ППБ, ассоциирован генотип GG по DNMT1 rs8101626. В соответствии с нашими данными, риск развития ППБ и РПБ повышается при наличии у женщин генотипа GG как по полиморфному локусу DNMT1 rs2228611 (OR = 3.0, 95% CI: 1.44–6.23; OR = 3.94, 95% CI: 1.92–8.09 соответственно), так и по DNMT1 rs8101626 (OR = 2.64, 95% CI: 1.2–5.76). Полученные результаты позволяют полагать, что генные варианты DNMT1 rs2228611 и DNMT1 rs8101626 ассоциированы с ранними репродуктивными потерями и могут являться генетическими факторами риска привычного невынашивания беременности.

Ключевые слова: потеря беременности на ранних сроках, привычное невынашивание беременности, DNMT1, DNMT3A.

DOI: 10.31857/S0016675820030029

Ранние репродуктивные потери (ранние потери беременности, РПБ) представляют собой потерю клинически диагностированной беременности на сроке до 12 нед. гестации [1]. Термин “привычное невынашивание беременности” (повторная потеря беременности, ППБ) используется в случае двух или более выкидышей подряд [2, 3]. Ранние потери составляют до 15% клинически диагностированных беременностей и 17–22% от всех беременностей [1, 4], при этом 80% выкидышей происходят до 12 нед. гестации, и после первого триместра их частота резко снижается [5]. Успешная беременность является результатом событий на гормональном, иммунологическом и клеточном уровнях, необходимых для оплодотворения, имплантации и развития эмбриона [6]. В 50–76% случаев привычного невынашивания, как правило обусловленного нарушениями имплантации и эмбрионального развития, вовлечена генетическая компонента [1]. Несмотря на то, что известен ряд эмбриональных и родительских факторов, играющих роль в развитии ППБ, в половине случаев причины остаются неизвестными и недостаточно изученными с генетической точки зрения [2, 7]. Обнаружены генные варианты, влияющие на экспрессию и активность ДНК-метилтрансфераз (DNMT), обеспечивающих метилирование ДНК de novo и поддержание паттернов метилирования во время гаметогенеза и раннего эмбриогенеза, и способные приводить к привычному невынашиванию беременности [8]. Метилирование ДНК в CpG-островках играет важную роль в регуляции экспрессии генов и геномном импринтинге. Данное явление обеспечивается активностью ДНК-метилтрансфераз, формирующих 5-метилцитозин с использованием S-аденозилметионина в качестве донора метильных групп. DNMT3A и DNMT3B устанавливают паттерны метилирования de novo, а DNMT3L взаимодействует с DNMT3A и DNMT3B, усиливая их связывание с ДНК и увеличивая таким образом их активность [9]. DNMT1 является ведущим ферментом, катализирующим присоединение метильных групп к неметилированной цепи гемиметилированной молекулы ДНК. Она играет ключевую роль в поддержании и стабилизации паттернов метилирования геномной ДНК у млекопитающих в процессе клеточного деления [10].

Представленное исследование направлено на изучение однонуклеотидных полиморфизмов (SNP) генов DNMT3A и DNMT1: DNMT3A rs7590760, DNMT1 rs2228611, DNMT1 rs8101626.

Генные варианты DNMT3A rs7590760 и DNMT1 rs8101626 были изучены у женщин с раком яичников и молочной железы [11, 12], но не исследовались у женщин с РПБ, что определяет новизну настоящей работы. Несколько трудов посвящены анализу DNMT1 rs2228611 у больных с раком яичника и раком желудка [11, 13, 14] и олигоспермией [15]. Единственное исследование, проведенное в Словении, было направлено на его изучение у женщин с привычным невынашиванием беременности [10]. Ни один из перечисленных вариантов в популяциях РФ ранее не исследовался. В связи с вышесказанным данные по трем SNP были отобраны для анализа их возможной ассоциации с РПБ и ППБ у женщин русской национальности.

С целью изучения полиморфных локусов генов DNMT (DNMT3A rs7590760, DNMT1 rs2228611, DNMT1 rs8101626) и определения их значимости в качестве материнского фактора риска РПБ и ППБ у женщин русской национальности, проживающих в Центральной России, нами было проведено исследование типа “случай–контроль”. Информированное согласие было получено от всех его участников. Проведение исследования одобрено Комитетом по этике Медицинского института РУДН. Для анализа использованы образцы ДНК 100 женщин с потерей беременности на ранних сроках, средний возраст которых составлял 31.5 ± ± 4.9 лет. Группа пациенток впоследствии была разделена на две подгруппы: со спорадическим выкидышем (СПБ, n = 50) и привычным невынашиванием беременности (ППБ, n = 50), в числе которых 21 женщина, не имевшая успешных беременностей (первичная ППБ), и 29 женщин, имевших ранее хотя бы одну успешную беременность (вторичная ППБ). Критерием исключения было наличие анатомических аномалий или хронических заболеваний, способных индуцировать потерю беременности. Группа сравнения (контроль) состояла из 56 женщин в возрасте 29.2 ± ± 3.5 лет с наличием нормально протекавших беременностей и неотягощенным акушерским и гинекологическим анамнезом.

Геномная ДНК была выделена из лейкоцитов периферической крови с использованием реагентов компании “Синтол” (РФ). Генотипирование по SNP DNMT3А rs7590760, DNMT1 rs2228611 и DNMT1 rs8101626 выполнено методом полимеразной цепной реакции с последующей рестрикцией ДНК (табл. 1). Для разделения полученных фрагментов применялся электрофорез в 3%-ном агарозном геле.

Таблица 1.

Условия генотипирования

Полиморфные варианты Праймеры (Евроген, РФ) Температура отжига Рестриктаза (Сибэнзим, РФ) Длина фрагментов ДНК, пн
DNMT3A rs7590760 F: 5'TGCTGTGCCTACTCCAAACA3'
R: 5'GCCATGAATGTCCAGAAGGT3'
62.6°C RsaI CC: 267, 76
CG: 267, 76, 343
GG: 343
DNMT1 rs2228611 F: 5'TATGTTGTCCAGGCTCGTCTC3'
R: 5'GTACTGTAAGCACGGTCACCTG3'
55°C BStMAI AA: 232, 28
AG: 232, 108, 124, 28
GG: 108, 124, 28
DNMT1 rs8101626 F: 5'CAAATGGGCCACCTAGACAC3'
R: 5'GGCAGAGATTGAGCCAGAAG3'
67°C BStMAI AA: 640
AG: 640, 474, 166
GG: 474, 166

Для сравнения частот аллелей и генотипов по DNMT3А rs7590760, DNMT1 rs2228611 и DNMT1 rs8101626 в изучаемых группах применялся критерий Хи-квадрат. Для теста Хи-квадрат и расчета отношения шансов (OR) и 95%-ного доверительного интервала (95% CI) использовалось программное обеспечение SPSS Statistics, версия 22.

Частоты изучаемых генотипов и аллелей в исследуемых группах представлены в табл. 2. Распределение генотипов и частота аллеля G по DNMT1 rs2228611 в группах с РПБ и ППБ статистически значимо отличаются от таковых в группе сравнения (контроле), в то время как достоверных отличий в группе с СПБ не обнаружено. Риск РПБ и ППБ у женщин возрастает при наличии гомозиготного GG генотипа (OR = 3.0, 95% CI: 1.44–6.23; OR = 3.94, 95% CI: 1.92–8.09 соответственно). Также нами обнаружено, что частота генотипа GG по DNMT1 rs8101626 в группах с РПБ, СПБ и ППБ достоверно выше, чем в контроле, а по другим генотипам (AA, AG) отличий не обнаружено. Таким образом, у женщин с генотипом GG риск ранней потери беременности возрастает в 1.9 раза (OR = 2.64, 95% CI: 1.2–5.76), но вместе с тем, частота аллеля G в группах с РПБ и ППБ выше соответствующей величины в контрольной группе лишь на уровне тенденции (P = = 0.071 и 0.084 соответственно). Распределение аллелей и генотипов по DNMT3А rs7590760 в изученных группах не отличается.

Таблица 2.  

Частоты генотипов и аллелей (%) по DNMT1 rs2228611, DNMT1 rs8101626 и DNMT3A rs7590760 в изучаемых группах

Генотипы и аллели Контроль (n = 56) РПБ (n = 100) СПБ (n = 50) ППБ (n = 50)
DNMT1 rs2228611
AA 42.9 30.0* 38.0 22.0*
AG 44.6 40.0 38.0 42.0
GG 12.5 30.0* 24.0 36.0*
A 65.2 50.0* 57.0 43.0*
G 34.8 50.0* 43.0 57.0*
DNMT1 rs8101626
AA 36.4 28.0 30.0 26.0
AG 52.7 48.0 46.0 50.0
GG 10.9 24.0* 24.0* 24.0*
A 62.75 52.0 53.0 51.0
G 37.25 48.0 47.0 49.0
DNMT3A rs7590760
CC 32.2 26.0 32.0 20.0
CG 46.4 52.0 48.0 56.0
GG 21.4 22.0 20.0 24.0
C 55.4 52.0 56.0 48.0
G 44.6 48.0 44.0 52.0

* – показатель достоверно отличается от контроля при р ≤ 0.05.

Программа развития эмбриона определяется как генетическими, так и эпигенетическими факторами. Метилирование ДНК выступает ведущим фактором, вносящим существенный вклад в репрограммирование генома во время гаметогенеза и эмбриогенеза. После оплодотворения материнский и отцовский паттерны метилирования, сформированные в гаметогенезе, подвергаются прогрессирующему деметилированию. При этом отцовская ДНК активно деметилируется до начала репликации, в то время как материнская ДНК деметилируется пассивно во время каждого клеточного деления до стадии бластоцисты, затем происходит быстрое реметилирование в постимплантационном периоде, что обеспечивает рост и дифференциацию [16]. Генетические исследования показали, что как de novo, так и поддерживающая метилтрансферазная активности необходимы для формирования паттернов метилирования у эмбриона. DNMT3A и DNMT3B играют ключевую роль в метилировании de novo и создании новых эмбриональных паттернов метилирования, в связи с чем их инактивация ведет к гибели эмбриона [17]. Как было отмечено выше, поддержание паттернов метилирования ДНК необходимо для развития эмбриона, и DNMT1 является ключевым ферментом, выполняющим данную задачу. Обнаружены две его изоформы: короткая изоформа DNMT1o, синтезируемая в зрелых ооцитах и в предимплантационном периоде, и длинная соматическая изоформа DNMT1s, образующаяся после оплодотворения и поддерживающая метилирование ДНК после имплантации эмбриона [18]. Установлено, что у гомозиготных DNMT1–/– эмбрионов после нескольких клеточных делений происходит уменьшение на 90% уровня метилирования СрG-островков из-за полной инактивации фермента, в результате чего развитие останавливается на стадии поздней гаструляции и наступает гибель [17, 19]. Эти данные доказывают тот факт, что DNMT1 является основной поддерживающей метилтрансферазой in vivo.

Исходя из вышесказанного, можно заключить, что изменение нуклеотидной последовательности DNMT1 может приводить к нарушениям метилирования, включая глобальное гипометилирование и ген-специфичное гиперметилирование, что, в свою очередь, может способствовать развитию заболеваний. Так, в ряде исследований было показано наличие ассоциации DNMT1 rs2228611 с риском развития рака яичников и молочной железы [1114], рака желудка [20], шизофрении [21] и снижением фертильности у мужчин [15]. Исследование, проведенное в Словении, показало значимость данного генного варианта для развития ППБ [10]. DNMT1 rs8101626 повышает риск развития рака яичников [11]. Другие варианты гена DNMT1 ассоциированы с чувствительностью к мутагенам [22] и колоректальным раком [23].

Несмотря на то, что эпигенетическое репрограммирование в последнее время представляет значительный интерес для исследователей и широко изучается у мышей, имеется мало информации относительно данного процесса в человеческих эмбрионах. Ген DNMT1 расположен в локусе 19p13.2. DNMT1 rs2228611 представляет собой синонимичную замену, однако он локализован в экзоне 17 вблизи сайта сплайсинга, и замена A>G ведет к появлению трех экзонных энхансеров сплайсинга [21]. DNMT1 rs8101626 локализуется в интроне 39 и вероятно влияет на регуляцию синтеза мРНК [24]. Ген DNMT3A находится в локусе 2p23.3. Рассматриваемый полиморфный локус DNMT3A rs7590760 расположен в интроне, и его влияние на экспрессию гена еще недостаточно изучено. Полученные в нашем исследовании результаты показывают, что DNMT1 rs2228611 ассоциирован с привычным невынашиванием беременности. Более того, мы подразделили пациенток с ППБ на подгруппы с первичной и вторичной ППБ и обнаружили, что частота генотипа GG по DNMT1 rs2228611 выше при первичной ППБ (42.9%), чем при вторичной (31.0%). Частота гетерозигот, напротив, выше в подгруппе со вторичной ППБ (48.3 и 33.3% соответственно). Можно предполагать, что потеря беременности также зависит от наличия отцовского мутантного аллеля DNMT1, приводящего к появлению эмбрионов с мутациями в обоих аллельных генах, однако данный вопрос требует дальнейшего изучения. Проведенное нами исследование также показало наличие достоверной ассоциации между генотипом GG по DNMT1 rs8101626 и РПБ, включая ППБ.

В целом полученные нами данные согласуются с исследованием, показавшим, что DNMT1 и DNMT3A экспрессируются в ворсинках хориона и децидуальной оболочке, а уровень DNMT1 значимо снижается при РПБ, в то время как экспрессия DNMT3A не меняется [25].

Таким образом, результаты проведенного исследования позволяют полагать, что наличие генотипа GG по полиморфным локусам DNMT1 rs2228611 или DNMT1 rs8101626 у женщин русской национальности способствует формированию генетической предрасположенности к ранним репродуктивным потерям и привычному невынашиванию беременности.

Все процедуры, выполненные в исследовании с участием людей, соответствуют этическим стандартам институционального и/или национального комитета по исследовательской этике и Хельсинкской декларации 1964 г. и ее последующим изменениям или сопоставимым нормам этики.

От каждого из включенных в исследование участников было получено информированное добровольное согласие.

Авторы заявляют, что у них нет конфликта интересов.

Список литературы

  1. Weintraub A.Y., Sheiner E. Early pregnancy loss // Bleeding during Pregnancy: A Comprehensive Guide. Springer Science + Business Media, LLC, 2011. P. 25–44. https://doi.org/10.1007/978-1-4419-9810-1_2

  2. Recurrent pregnancy loss: Guideline of the European Society of Human Reproduction and Embryology [online]. 2017. 152 p. https://www.eshre.eu/Guidelines-and-Legal/Guidelines/Recurrent-pregnancy-loss.

  3. El Hachem H., Crepaux V., May-Panloup P. et al. Recurrent pregnancy loss: current perspective // Int. J. Womens Health. 2017. V. 9. P. 331–345. https://doi.org/10.2147/IJWH.S100817

  4. García-Enguídanos A., Calle M.E., Valero J. et al. Risk factors in miscarriage: A review // Eur. J. Obstetrics, Gynecol., and Reprod. Biol. 2002. V. 102. № 2. P. 111–119.

  5. Bolor H., Mori T., Nishiyama S. et al. Mutations of the SYCP3 gene in women with recurrent pregnancy loss // Am. J. Hum. Genet. 2009. V. 84. № 1. P. 14–20. https://doi.org/10.1016/j.ajhg.2008.12.002

  6. Foulk R.A. Implantation of the human embryo // Advances in Embryo Transfer / Ed. Bin Wu. In tech. available from: http://www.intechopen.com/books/advances-in-embryotransfer/implantation-of-the-embryo. 2012. P. 193–206.

  7. Scott J.R., Gibbs R.S., Karlan B.Y., Haney A.F. Danforth’s Obstetrics and Gynecology. Philadelphia, PA: Lippincott Williams and Wilkins, 2003. 48 p.

  8. Tajima S., Suetake I., Takeshita K. et al. Domain structure of the Dnmt1, Dnmt3a, and Dnmt3b DNA methyltransferases // Adv. Exp. Med. Biol. 2016. V. 945. P. 63–86.

  9. Lyko F. The DNA methyltransferase family: a versatile toolkit for epigenetic regulation // Nat. Rev. Genet. 2018. V. 19. № 2. P. 81–92. https://doi.org/10.1007/978-3-319-43624-1_4

  10. Barišić A., Pereza N., Hodžić A. et al. A single nucleotide polymorphism of DNA methyltransferase 3B gene is a risk factor for recurrent spontaneous abortion // Am. J. Reprod. Immunol. 2017. V. 78. № 6. P. 1–7. https://doi.org/10.1111/aji.12765

  11. Mostowska A., Sajdak S., Pawlik P. et al. DNMT1, DNMT3A and DNMT3B gene variants in relation to ovarian cancer risk in the Polish population // Mol. Biol. Rep. 2013. V. 40. № 8. P. 4893–4899. https://doi.org/10.1007/s11033-013-2589-0

  12. Xiang G., Zhenkun F., Shuang C. et al. Association of DNMT1 gene polymorphisms in exons with sporadic infiltrating ductal breast carcinoma among Chinese Han women in the Heilongjiang province // Clin. Breast Cancer. 2010. V. 10. № 5. P. 373–377. https://doi.org/10.3816/CBC.2010.n.049

  13. Kelemen L.E., Sellers T.A., Schildkraut J.M. et al. Genetic variation in the one-carbon transfer pathway and ovarian cancer risk // Cancer Research. 2008. V. 68. № 7. P. 2498–2506. https://doi.org/10.1158/0008-5472.CAN-07-5165

  14. Sun M.Y., Yang X.X., Xu W.W. et al. Association of DNMT1 and DNMT3B polymorphisms with breast cancer risk in Han Chinese women from South China // Genet. Mol. Res. 2012. V. 11. № 4. P. 4330–4341. https://doi.org/10.4238/2012.September.26.1

  15. Cheng P., Chen H., Zhang R.P. et al. Polymorphism in DNMT1 may modify the susceptibility to oligospermia // Reprod. Biomed. Online. 2014. V. 28. № 5. P. 644–649. https://doi.org/10.1016/j.rbmo.2014.01.003

  16. Li E. Chromatin modification and epigenetic reprogramming in mammalian development // Nat. Rev. Genet. 2002. V. 3. № 9. P. 662–673. https://doi.org/10.1038/nrg887

  17. Okano M., Bell D.W., Haber D.A. et al. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development // Cell. 1999. V. 99. № 3. P. 247–257.

  18. Gaudet F., Rideout W.M., Meissner A. et al. Dnmt1 expression in pre- and postimplantation embryogenesis and the maintenance of IAP silencing // Mol. Cell Biol. 2004. V. 24. № 4. P. 1640–1648.

  19. Li E., Bestor T.H., Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality // Cell. 1992. V. 69. № 6. P. 915–926.

  20. Jia Z., Wu X., Cao D. et al. Polymorphisms of the DNA methyltransferase 1 gene predict survival of gastric cancer patients receiving tumorectomy // Disease Markers. 2016. 2016: 8578064. https://doi.org/10.1155/2016/8578064

  21. Saradalekshmi K.R., Neetha N.V., Sathyan S. et al. DNA methyl transferase (DNMT) gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia // PLoS One. 2014. V. 9. № 5. e98182. https://doi.org/10.1371/journal.pone.0098182

  22. Leng S., Stidley C.A., Bernauer A.M. et al. Haplotypes of DNMT1 and DNMT3B are associated with mutagen sensitivity induced by benzo[a]pyrenediol epoxide among smokers // Carcinogenesis. 2008. V. 29. № 7. P. 1380–1385. https://doi.org/10.1093/carcin/bgn121

  23. Kanai Y., Ushijima S., Nakanishi Y. et al. Mutation of the DNA methyltransferase (DNMT) 1 gene in human colorectal cancers // Cancer Lett. 2003. V. 192. № 1. P. 75–82.

  24. Yang S.M., Huang C.Y., Shiue H.S. et al. Combined effects of DNA methyltransferase 1 and 3A polymorphisms and urinary total arsenic levels on the risk for clear cell renal cell carcinoma // Toxicol. Appl. Pharmacol. 2016. V. 305. P. 103–110. https://doi.org/10.1016/j.taap.2016.06.011

  25. Yin L.J., Zhang Y., Lv P.P. et al. Insufficient maintenance DNA methylation is associated with abnormal embryonic development // BMC Med. 2012. V. 10. № 26. https://doi.org/10.1186/1741-7015-10-26

Дополнительные материалы отсутствуют.